Single TF

$$\newcommand{\kon}{k_{\mathrm{on}}} \newcommand{\koff}{k_{\mathrm{off}}}$$

There exist two mathematical formalisms to describe the probabilities of molecular configurations at equilibrium: thermodynamics and kinetics. In the kinetics formalism, the system transits between configurational states according to rate parameters contained in differential equations, which can describe not just the system's equilibrium but also its trajectory towards it, or the kinetics of non-equilibrium systems. In the thermodynamics/statistical mechanics formalism, we posit that a system will occupy configurations with lower energy, and use the Boltzmann distribution to estimate the proportion of time the system spends in each state, at equilibrium. The thermodynamics formalism is limited to describing equilibrium state probabilities, but it does so with fewer parameters.

We'll derive an expression for the probability of a single TFBS' occupancy with both formalisms, but proceed with the thermodynamic description for more elaborate configurations. It will become clear why that is preferable.

Kinetics

Most derivations of the probability of single TFBS occupancy at equilibrium employ a kinetics formalism, so we'll walk through that first, and then explore the analog in the thermodynamics description. In the kinetics description, the parameters are rates.

$$ \mathrm{TF} + \mathrm{TFBS} \underset{\koff}{\overset{\kon}{\rightleftarrows}} \mathrm{TF\colon TFBS} $$

The natural rates are the rate of TF binding $\kon$ and unbinding $\koff$. Equilibrium is reached when binding and unbinding are balanced:

$$\frac{d[\mathrm{TF\colon TFBS}]}{dt} = k_{\mathrm{on}}[\mathrm{TF}][\mathrm{TFBS}] - k_{\mathrm{off}}[\mathrm{TF\colon TFBS}] = 0 \text{ at equilibrium}$$ $$k_{\mathrm{on}}[\mathrm{TF}]_{\mathrm{eq}}[\mathrm{TFBS}]_{\mathrm{eq}} = k_{\mathrm{off}}[\mathrm{TF\colon TFBS}]_{\mathrm{eq}}$$ $$\text{(dropping eq subscript) }[\mathrm{TF\colon TFBS}] = \frac{k_{\mathrm{on}}[\mathrm{TF}][\mathrm{TFBS}]}{k_{\mathrm{off}}} = \frac{[\mathrm{TF}][\mathrm{TFBS}]}{k_{d}}$$

where $k_{d} = \frac{\koff}{\kon}$ is called the dissociation constant (or equilibrium constant). We'd like to determine the probability of finding the TFBS occupied, i.e. the fraction of time it spends in the bound state. That fraction is $\frac{[\mathrm{bound}]}{([\mathrm{unbound}] + [\mathrm{bound}])} = \frac{[\mathrm{TF\colon TFBS}]}{([\mathrm{TFBS}] + [\mathrm{TF\colon TFBS}])}$. Define the denominator as $[\mathrm{TFBS}]_{0} = [\mathrm{TFBS}] + [\mathrm{TF\colon TFBS}]$ so that $[\mathrm{TFBS}] = [\mathrm{TFBS}]_{0} - [\mathrm{TF\colon TFBS}]$ and substitute:

$$[\mathrm{TF\colon TFBS}] = \frac{[\mathrm{TF}]([\mathrm{TFBS}]_{0} - [\mathrm{TF\colon TFBS}])}{k_{d}}$$ $$[\mathrm{TF\colon TFBS}](k_d + [\mathrm{TF}]) = [\mathrm{TF}][\mathrm{TFBS}]_{0}$$ $$\frac{[\mathrm{TF\colon TFBS}]}{[\mathrm{TFBS}]_{0}} = \frac{[\mathrm{TF}]}{k_d + [\mathrm{TF}]}$$

Note: We could also ask for this expression in terms of $[\mathrm{TF}]_0 = [\mathrm{TF}] + [\mathrm{TF\colon TFBS}]$ however, since we’re considering a single TFBS, $[\mathrm{TF\colon TFBS}]$ is at most 1, and so $[\mathrm{TF}]_0 \approx [\mathrm{TF}]$. In instances of ligand-receptor binding in which that approximation cannot be made, the fraction bound is a messy quadratic. Derivation here.

Thermodynamics

In the thermodynamics description, the parameters are Gibbs free energies $\Delta G$. Let's follow the derivation from Physical Biology of the Cell (pp. 242) and consider the number microstates underlying each of the of bound and unbound macrostates, and their energies.

In order to count microstates, we imagine distributing $L$ TF molecules across a space-filling lattice with $\Omega$ sites. The energy of a TF in solution is $\varepsilon_{\mathrm{solution}}$ and the energy of a bound TF is $\varepsilon_{\mathrm{bound}}$. $\beta$ is the constant $1/k_b T$ where $k_b$ is Boltzmann's constant and $T$ is the temperature.

StateEnergyMultiplicityWeight
$A \cdot A_s$ $\frac{\Omega!}{(\Omega - A)!A!} \approx \frac{\Omega^{A}}{A!}$ $\frac{\Omega^{A}}{A!} \cdot e^{-\beta \left[ A \cdot A_s \right]}$
$(A - 1) A_s + A_b$ $\frac{\Omega!}{(\Omega - (A - 1))!(A-1)!B!} \approx \frac{\Omega^{A-1}}{(A-1)!}$ $\frac{\Omega^{A-1}}{(A-1)!} \cdot e^{-\beta \left[ (A - 1) A_s + A_b \right]}$

In our case, the number of microstates in the unbound macrostate is $\frac{\Omega !}{L!(\Omega -L)!}\approx \frac{\Omega^L}{L!}$ and they each have energy $L \cdot \varepsilon_s$. The number of microstates in the bound macrostate is $\frac{\Omega !}{(L-1)!(\Omega -(L+1))}\approx \frac{\Omega^{(L-1)}}{(L-1)!}$ and they each have energy $(L-1) \varepsilon_s + \varepsilon_b$.

The Boltzmann distribution describes the probability of a microstate as a function of its energy: $p(E_i) = e^{-\beta E_i}/Z$ where $Z$ is the "partition function" or simply $\sum_i e^{-\beta E_i}$ the sum of the weights of the microstates, which normalizes the distribution. In our case:

$$Z(L,\Omega)=\left(\colorbox{LightCyan}{$ \frac{\Omega^L}{L!} e^{-\beta L \varepsilon_s}$}\right) + \left(\colorbox{Seashell}{$\frac{\Omega^{(L-1)}}{(L-1)!} e^{-\beta [(L-1) \varepsilon_s + \varepsilon_b]}$}\right)$$

With that expression in hand, we can express the probability of the bound macrostate, $p_b$:

$$p_b=\frac{ \colorbox{Seashell}{$\frac{\Omega^{(L-1)}}{(L-1)!} e^{-\beta [(L-1) \varepsilon_s + \varepsilon_b]}$}}{\colorbox{LightCyan}{$\frac{\Omega^L}{L!} e^{-\beta L \varepsilon_s}$} + \colorbox{Seashell}{$\frac{\Omega^{(L-1)}}{(L-1)!} e^{-\beta [(L-1) \varepsilon_s + \varepsilon_b]}$}} \cdot \color{DarkRed}\frac{\frac{\Omega^L}{L!}e^{\beta L \varepsilon_s}}{\frac{\Omega^L}{L!}e^{\beta L \varepsilon_s}} \color{black} = \frac{(L/\Omega)e^{- \beta \Delta \varepsilon}}{1+(L/\Omega)e^{- \beta \Delta \varepsilon}} $$

Where we have defined $\Delta \varepsilon = \varepsilon_b - \varepsilon_s$. $L/\Omega$ is really just a dimensionless TF concentration, which we'll hand-wave as being equivalent to $[\mathrm{TF}]$, which leaves us with an expression suspiciously similar to the one we derived from the kinetics formalism:

$$p_b = \frac{[\mathrm{TF}]e^{-\beta \Delta \varepsilon}}{1+[\mathrm{TF}]e^{-\beta \Delta \varepsilon}} \cdot \color{DarkRed}\frac{e^{\beta \Delta \varepsilon}}{e^{\beta \Delta \varepsilon}} \color{black} = \frac{[\mathrm{TF}]}{e^{\beta \Delta \varepsilon}+[\mathrm{TF}]}$$

From which we recapitulate an important correspondence between kinetics and thermodynamics at equilibrium: $ k_d = e^{\beta \Delta \varepsilon} = e^{\Delta \varepsilon / k_bT} $ more commonly written for different units as $k = e^{-\Delta G / RT}$.

The takeaway is that both the kinetics and thermodynamics formalisms produce an equivalent expression for the probabilities of each of the bound and unbound configurations, parameterized respectively by $k_d$ and $\Delta G$.

Sample Values

In order to compute probabilities like $p_b$, we need concrete TF concentrations $[\mathrm{TF}]$ and binding affinities (either $k_d$ or $\Delta G$). What are typical intranuclear TF concentrations and binding affinities?

Concentrations

A typical human cell line, K562s, have a cellular diameter of 17 microns. (BioNumbers)

def sphere_volume(d):
    return 4/3*np.pi*(d/2)**3

K562_diameter_microns = 17
K562_volume_micron_cubed = sphere_volume(K562_diameter_microns)
print(f'K562 volume: {round(K562_volume_micron_cubed)} μm^3')
K562 volume: 2572 μm^3

A typical expressed TF has a per-cell copy number range from $10^3$ - $10^6$. (BioNumbers)

copy_number_range = [1e3, 1e6]
N_A = 6.02214076e23

def copy_number_and_cubic_micron_volume_to_molar_concentration(copy_number, volume=K562_volume_micron_cubed):
    return (copy_number / N_A) / (volume * (1e3 / 1e18))  # 1000 Liters / m^3; 1e18 μm^3 / m^3

lower_end_molar = copy_number_and_cubic_micron_volume_to_molar_concentration(copy_number_range[0], K562_volume_micron_cubed)
upper_end_molar = copy_number_and_cubic_micron_volume_to_molar_concentration(copy_number_range[1], K562_volume_micron_cubed)

lower_end_nanomolar = lower_end_molar / 1e-9
upper_end_nanomolar = upper_end_molar / 1e-9

print('If TF copy numbers range from 1,000-1,000,000, then TF concentrations range from', str(round(lower_end_nanomolar))+'nM', 'to', str(round(upper_end_nanomolar))+'nM')
If TF copy numbers range from 1,000-1,000,000, then TF concentrations range from 1nM to 646nM

We might also like a distribution over this range. Let's posit a lognormal, where $10^3$ and $10^6$ are the 3σ from the mean, which is $10^{4.5}$. Then $\sigma = 10^{0.5}$

Affinities

What are typical TF ΔG's of binding? How about the $\koff$ rates and half lives?

  • We can use the prior knowledge that dissociation constants should be in the nanomolar regime (BioNumbers).
  • We can use the relation that $\Delta G = -k_b T \cdot \ln(k_d)$ (Plugging in 310°K (human body temp) and the Boltzmann constant $k_b$ in kcal/Mol)
  • We use the approximation that $\kon$ is ~$10^5 / $ Molar $ \times $ sec (Wittrup)
T = 310
k_b = 3.297623483e-24 * 1e-3  ## cal/K * kcal/cal
kbT = k_b*T*N_A
kbT  ## in 1/Mol -- an unusual format

k_on = 1e5

def nanomolar_kd_from_kcal_ΔG(ΔG): return exp(-ΔG/kbT) * 1e9
def kcal_ΔG_from_nanomolar_kd(K_d): return -kbT*ln(K_d*1e-9)
def k_off_from_nanomolar_kd(k_d): return (k_d*1e-9) * k_on
def half_life_from_kd(k_d): return ln(2) / ((k_d*1e-9) * k_on)
$\Delta G$ $\kon$ $\koff$ $t_{1/2}$
$k_d$
1 12.757685 1e5 / (M * s) 0.0001 0 days 01:55:31.471805599
10 11.340164 1e5 / (M * s) 0.0010 0 days 00:11:33.147180560
100 9.922644 1e5 / (M * s) 0.0100 0 days 00:01:09.314718056
1000 8.505123 1e5 / (M * s) 0.1000 0 days 00:00:06.931471806

We learn that an order of magnitude residence time difference results from just 1.4 extra kcal/Mol, and that TF half lives range from about 5s to about 2h. Let's once again posit a distribution of affinities to sample from (defined on $k_d$):

With those concrete TF concentrations and dissociation constants, we can finally plot our function $p_b = \frac{[\mathrm{TF}]}{e^{\beta \Delta \varepsilon}+[\mathrm{TF}]}$.

@np.vectorize
def fraction_bound(TF, ΔG):
    '''TF in nanomolar'''
    return TF / (TF + nanomolar_kd_from_kcal_ΔG(ΔG))

(Note that both $[\mathrm{TF}]$ and $k_d$ are plotted in log space, but $p_b$ is linear.)

Multiple TFs: Direct Cooperativity & Competition

Suppose now that two TFs bind adjacent segments of DNA in such a way that the binding of either facilitates (or hinders) the binding of the other. We call this direct cooperativity (and competition). We'll focus first on cooperativity.

Cooperativity

As before, the statistical mechanics formalism entails enumerating the configurations, their multiplicities, and their energies. We'll call the TFs A and B. We'll denote their counts as $A$ and $B$. The energy of a TF in solution will once more be $A_s$ and bound to its cognate TFBS $A_b$. The energy of cooperativity will be $C_{AB}$.

StateEnergyMultiplicityWeight
$A \cdot A_s + B \cdot B_s$ $\frac{\Omega!}{(\Omega - A - B)!A!B!} \approx \frac{\Omega^{A+B}}{A!B!}$ $\frac{\Omega^{A+B}}{A!B!} \cdot e^{-\beta \left[ A \cdot A_s + B \cdot B_s \right]}$
$(A - 1) A_s + A_b + B \cdot B_s$ $\frac{\Omega!}{(\Omega - (A - 1) - B)!(A-1)!B!} \approx \frac{\Omega^{A+B-1}}{(A-1)!B!}$ $\frac{\Omega^{A+B-1}}{(A-1)!B!} \cdot e^{-\beta \left[ (A - 1) A_s + A_b + B \cdot B_s \right]}$
$A \cdot A_s + (B - 1) B_s + B_b$ $\frac{\Omega!}{(\Omega - A - (B - 1))!A!(B-1)!} \approx \frac{\Omega^{A+B-1}}{A!(B-1)!}$ $\frac{\Omega^{A+B-1}}{A!(B-1)!} \cdot e^{-\beta \left[ A \cdot A_s + (B - 1) B_s + B_b \right]}$
$(A - 1) A_s + A_b + (B - 1) B_s + B_b + C_{AB}$ $\frac{\Omega!}{(\Omega - (A - 1) - (B-1))!(A-1)!(B-1)!} \approx \frac{\Omega^{A+B-2}}{(A-1)!(B-1)!}$ $\frac{\Omega^{A+B-2}}{(A-1)!(B-1)!} \cdot e^{-\beta \left[ (A - 1) A_s + A_b + (B - 1) B_s + B_b + C_{AB} \right]}$

The partition function is the sum of the weights:

$$ Z = \frac{\Omega^{A+B}}{A!B!} \cdot e^{-\beta \left[ A \cdot A_s + B \cdot B_s \right]} + \frac{\Omega^{A+B-1}}{(A-1)!B!} \cdot e^{-\beta \left[ (A - 1) A_s + A_b + B \cdot B_s \right]} + \frac{\Omega^{A+B-1}}{A!(B-1)!} \cdot e^{-\beta \left[ A \cdot A_s + (B - 1) B_s + B_b \right]} + \frac{\Omega^{A+B-2}}{(A-1)!(B-1)!} \cdot e^{-\beta \left[ (A - 1) A_s + A_b + (B - 1) B_s + B_b + C_{AB} \right]}$$

Which we can greatly simplify by multiplying the entire expression by the reciprocal of the "base state" weight, $\color{DarkRed}\frac{A!B!}{\Omega^{A+B}} \cdot e^{\beta \left[ A \cdot A_s + B \cdot B_s \right]}$, normalizing that weight to 1:

$$ Z = 1 + \frac{A}{\Omega} \cdot e^{-\beta \left[ A_b-A_s \right]} + \frac{B}{\Omega} \cdot e^{-\beta \left[ B_b-B_s \right]} + \frac{A \cdot B}{\Omega^2} \cdot e^{-\beta \left[ A_b-A_s+B_b-B_s+C_{AB} \right]}$$

Taking the definition $[A] = A/\Omega$ and $\Delta G_A = A_b-A_s$ produces:

$$ Z = 1 + [A] e^{-\beta \left[ \Delta G_A \right]} + [B] e^{-\beta \left[ \Delta G_B \right]} + [A][B] e^{-\beta \left[ \Delta G_A+\Delta G_B+C_{AB} \right]}$$

Then the probability of any state is just the weight of that state (scaled by the weight of the base state) divided by the partition function expression $Z$.

From the above, we notice the form of the expression for the weight of a configuration of N TFBSs:

$$ p_{\mathrm{config}} = \prod_{i \in \, \mathrm{bound \,TBFS}} \left( [\mathrm{TF}_{\mathrm{cognate}(i)}] \cdot e^{-\beta \left[ \Delta G_i + \sum_j c_{ij} \right]} \right) / Z$$

For numerical stability, we take the log of the unnormalized probability (that is, the weight) of configurations:

$$ \log(\tilde{p}_{\mathrm{config}}) = \sum_{i \in \, \mathrm{bound \,TBFS}} \left( \log([\mathrm{TF}_{\mathrm{cognate}(i)}]) - \beta \left[ \Delta G_i + \sum_j c_{ij} \right] \right) $$

Competition

Incorporating competition into our thermodynamic model is slightly more subtle than cooperativity, because we can imagine two types of competition

  • Two TFs which may both bind DNA at adjacent sites, causing a free energy penalty due to some unfavorable interaction.
  • Two TFs with overlapping DNA binding sites, which cannot physically be bound at the same time.

In the former case, the expression for $p_\mathrm{config}$ we had written before suffices, with values of $C_{AB}$ having both signs to represent cooperativity and competition. Nominally, the latter case also fits this formalism if we allow $C_{AB}$ to reach $-\infty$, but that would cause us headaches in the implementation. Instead, the weights of all those configurations which are not physical attainable, due to "strict" competitive binding between TFs vying for overlapping binding sites, are merely omitted from the denominator $Z$.

Sample cooperativity values

In order to compute concrete probabilities of configurations, accounting for cooperativity and competition, we will need concrete energies. We'll take $C_{AB}$ to be distributed exponentially with a mean at 2.2kcal/Mol. (Forsén & Linse).

Let's check our derivation (and our implementation) of $p_\mathrm{config}$ by comparing it to our direct computation of $p_b$ from §1. Single TF.

def enumerate_configs(TFBSs): return list(map(np.array, itertools.product([0,1], repeat=len(TFBSs))))

def p_configs(TFBSs, TF_conc, cooperativities):

    configs = enumerate_configs(TFBSs)
    weights = []

    for config in configs:

        weights.append(np.exp(log_P_config(config, TFBSs=TFBSs, TF_conc=TF_conc, cooperativities=cooperativities)))

    return list(zip(configs, np.array(weights) / sum(weights)))
p_bound (prev method): 	 0.00921878699097193
p_config (new method): 	 [(array([0]), 0.9907812130090282), (array([1]), 0.00921878699097194)]

With that sanity check, let's now consider the scenario of two transcription factors with cooperative binding, and compute the probabilities of each of the 4 configurations:

Low-Affinity binding

In reality, transcription factors' binding sites are not so discretely present or absent: transcription factors may bind anywhere along the DNA polymer, with an affinity dependent on the interaction surface provided by the sequence of nucleotides at each locus. There are a variety of approaches to model the sequence-to-affinity function for each TF. The simplest is to consider each nucleotide independently, and list the preferences for each nucleotide at each sequential position in a matrix. This type of "mono-nucleotide position weight matrix" (PWM) model is commonly used, and frequently represented by a "sequence logo" plot.

PWMs: Construction

I have curated PWMs from various databases for ~1000 human TFs.

tfdb2 = pd.read_json('../../AChroMap/data/processed/TF.2022.json').fillna(value=np.nan)  ## prefer nan to None

cisbp_pwms = pd.read_pickle('../../tfdb/data/processed/CISBP_2_PWMs.pickle')
humanTFs_pwms = pd.read_pickle('../../tfdb/data/processed/HumanTFs_PWMs.pickle')
jaspar2022_pwms = pd.read_pickle('../../tfdb/data/processed/jaspar2022_PWMs.pickle')
probound_pwms = pd.read_json('../../AChroMap/data/processed/TF_ProBound.json', orient='records').T  # we only get probound as delta G scores, not as PWMs

As an example, consider the Transcription Factor SPI1 / PU.1, for which the following PWMs are registered in the CisBP 2.00 database:

SPI1_pwms = tfdb2.loc[(tfdb2.Name == 'SPI1')]

SPI1_cisbp_pwms = cisbp_pwms.loc[SPI1_pwms.CISBP_2_strict.iat[0]]
SPI1_humanTFs_pwms = humanTFs_pwms.reindex(SPI1_pwms.HumanTFs.iat[0]).dropna()
SPI1_jaspar2022_pwms = jaspar2022_pwms.loc[SPI1_pwms.JASPAR_2022.iat[0]]
SPI1_probound_pwms = probound_pwms.loc[SPI1_pwms.ProBound.iat[0]].pwm
for (name, SPI1_pwm), offset in zip(SPI1_cisbp_pwms.items(), (0,0,2,0,0,0)):
    ax = plot_pwm(SPI1_pwm, figsize=((len(SPI1_pwm)+offset+1)*0.25,1), xtick_offset=offset)
    ax.set_title(name, loc='left')

This representation of this matrix visualizes the proportion of occurrences of a base at a particular position in aligned SPI1 binding sites. Since they look similar, we may be tempted to average them to have a single model of PU.1 binding, however it is considered unwise to do so, as TFs are believed to have multiple binding "modes" which refers explicitly to modes in the distribution of sequence-binding affinities.

These PWM models can be fit from a variety of experiments measuring PU.1 binding. In this case, we're looking at models fit from High-Throughput SELEX data, but other models for PU.1 binding generated from other types of experiments are catalogued at its entry in the HumanTFs database.

PWMs: scoring sequences

If we assume a TF's PWM catalogues its relative binding preferences to every possible sequence of individual bases, we can use that PWM to evaluate the relative probabilities of TF binding to new sequences. We'll define the PWM "score" as the (log) ratio of the probability of the sequence with the PWM against random chance. The probability of a sequence under the PWM is $\prod \mathrm{PWM}[i][\mathrm{dna}[i]]$. The probability of the sequence under a background model is $\prod \mathrm{bg}(\mathrm{dna}[i])$ where $\mathrm{bg}$ describes the frequency of each base in the genome (not quite 1/4 in the human genome). We take the logarithm of the ratio of these two probabilities to produce the log-likelihood ratio, which we call our "score":

$$\mathrm{score}(\mathrm{PWM}, j) = \log(\frac{\prod \mathrm{PWM}[i][\mathrm{dna}[j+i]]}{\prod \mathrm{bg}(\mathrm{dna}[j+i])}) = \sum \log(\frac{ \mathrm{PWM}[i][\mathrm{dna}[j+i]]}{\mathrm{bg}(\mathrm{dna}[j+i])}) $$

A positive $\mathrm{score}(\mathrm{PWM}, j)$ indicates the subsequence starting at position $j$ is likelier under the PWM model than a random sequence from the human genome, and a negative score indicates the subsequence is more likely to be random. Let's visualize a PU.1 scoring matrix:

bg = [0.2955, 0.2045, 0.2045, 0.2955]
pseudocount = 0.0001

def log_odds_pwm(pwm):
    return np.log((pwm+pseudocount)/bg)
pwm = SPI1_cisbp_pwms.iloc[1]
pwm_name = SPI1_cisbp_pwms.index[0]
ax = plot_pwm(log_odds_pwm(pwm), figsize=(4,4))
_ = ax.set_ylabel('score',  weight='bold')
cisbp_score_pwms = cisbp_pwms.apply(log_odds_pwm)
humanTFs_score_pwms = humanTFs_pwms.apply(log_odds_pwm)
jaspar2022_score_pwms = jaspar2022_pwms.apply(log_odds_pwm)

SPI1_cisbp_score_pwms = cisbp_score_pwms.loc[SPI1_pwms.CISBP_2_strict.iat[0]]
SPI1_humanTFs_score_pwms = humanTFs_score_pwms.reindex(SPI1_pwms.HumanTFs.iat[0]).dropna()
SPI1_jaspar2022_score_pwms = jaspar2022_score_pwms.loc[SPI1_pwms.JASPAR_2022.iat[0]]

Our strategy will be to score genomic regions for TF binding, searching for high PWM scores starting at every offset $j$ in the supplied DNA sequence. Let's remind ourselves here that in order to find the full set of motif matches in a supplied DNA sequence, we either need to scan the reference genome and its reverse complement, or scan the positive strand with both the forward and reverse-complement PWMs. We opt for the latter approach, and therefore augment our PWM set with reverse-complement PWMs:

plot_pwm(pwm, figsize=(4,1)).set_title('Forward: '+pwm_name, loc='left')
plot_pwm(reverse_complement_pwm(pwm), figsize=(4,1)).set_title('Reverse: '+pwm_name, loc='left')
None

Since we now have sequence-dependent transcription factor binding models, we will select a sequence which harbors known binding sites for select transcription factors, and see whether the models predict binding of those transcription factors.

As a specific sequence, let's use the SPI1 promoter.

def get_reference_transcript(gene_name):

    hg38_reference_annotation = pd.read_csv('../../AChroMap/data/processed/GRCh38_V29.csv')
    reference_transcript = hg38_reference_annotation[(hg38_reference_annotation.gene_name == gene_name) & (hg38_reference_annotation.canonicity == 0)]
    chrom = reference_transcript.chr.iat[0]
    strand = reference_transcript.strand.iat[0]
    tss = (reference_transcript.txStart if all(reference_transcript.strand == 1) else reference_transcript.txEnd).iat[0]

    return chrom, strand, tss
gene_name = 'SPI1'

chrom, strand, tss = get_reference_transcript(gene_name)
start = tss-400
stop = tss+400
def get_hg38_bases_local(chrom, start, stop):
    seqkit_command = f'seqkit subseq /Users/alex/Documents/AChroMap/data/raw/genome/hg38_fa/{chrom}.fa --region {start}:{stop}'
    dna = subprocess.run(shlex.split(seqkit_command), stdout=subprocess.PIPE).stdout.decode('utf-8').split('\n',1)[1].replace('\n','')
    return dna
SPI1_promoter_dna_sequence = get_hg38_bases_local(chrom, start, stop)
print(SPI1_promoter_dna_sequence)
TTCCAGGGAGGAAACCCTGACTTCCCACTGATAGCAAGCCAGGAGGGCAGTGGGTGGGCTGGCGGGTTCGTGGGCAGGCAGGCAGGCGTCCGAGGGCCACGGGTTGGGCTGGTGGAGGAGTCCCGGTACTCACAGGGGGGACGAGGGGAAACCCTTCCATTTTGCACGCCTGTAACATCCAGCCGGGCTCCGAGTCGGTCAGATCCCCTGCCTCGGTGGGGGCCAATGCAGAGCCCCTCAGGATGGGGTGCCCCGTCAGGGGCTGGACGGTCGTGGGGCGGGTGCAGGGCTCAGGCCTGCCCCCTGAGCTACAGGAGCCCTGGGTGAGCCCCCTCCCTTGACATTGCAGGGCCAGCACAAGTTCCTGATTTTATCGAAGGGCCTGCCGCTGGGAGATAGTCCCCTTGGGGTGACATCACCGCCCCAACCCGTTTGCATAAATCTCTTGCGCTACATACAGGAAGTCTCTGGCCGGCTGGGGCAGGTGGTGCTCAAAGGGCTGGCCTGGGAAGCCATGGGGTCCAGGCCCCCTGCCCAGAGGAAGCTGGGACTGAGAGGGATGACTTTGGGGGCTAAGCTGGGGAGGGAGGATGGGAGGGAGAACGTGTAGCTCTGCCACACCACTGGGAGGCTTTTGCTCTAACCCAACAAATGCCTGCTTCTTTTGAGATCCCTATGTAGCCAACAGTCACCTCATTGGGGTCAGAGCTGGAAGGGGTGGCCTCTTGGGGCCTCCACTTTCTGGAGTCAGCCTTCCTGGGTGAGGGCTCTGATCTAGCAGGCTATCAGGCCTGGCTCTTC

SPI1 promotes its own transcription, by binding to its own promoter. We can scan the SPI1 promoter for significant SPI1 PWM scores to locate the binding site.

base_index = {'a':0,'c':1,'g':2,'t':3,'A':0,'C':1,'G':2,'T':3}

def scan_sequence(pwm, dna):
    scores = []

    for i in range(len(dna)):
        score = 0
        for j, row in enumerate(pwm):
            if i+j < len(dna):
                score += row[base_index[dna[i+j]]]

        scores.append(score)

    return np.array(scores)
SPI1_PWM_scores = pd.DataFrame(SPI1_cisbp_score_pwms.apply(scan_sequence, args=(SPI1_promoter_dna_sequence,)).values.tolist(), index=SPI1_cisbp_score_pwms.index).T
SPI1_PWM_scores.index += start

positive_SPI1_PWM_scores = pd.DataFrame(np.where(SPI1_PWM_scores > 0, SPI1_PWM_scores, np.nan), index=SPI1_PWM_scores.index, columns=SPI1_PWM_scores.columns)
def genomic_xticks(ax, chrom=None):
    xlims = ax.get_xlim()
    xtick_vals = ax.get_xticks()
    ax.set_xticks(xtick_vals)
    ax.set_xticklabels(['{:.0f}'.format(x) for x in xtick_vals])
    ax.set_xlim(xlims)
    if chrom: ax.set_xlabel(chrom)

ax = SPI1_PWM_scores.plot(lw=0.1, xlim=(SPI1_PWM_scores.index.min(),SPI1_PWM_scores.index.max()), legend=False)
ax = positive_SPI1_PWM_scores.plot(style=".", ax=ax)
ax.set_ylabel('score')
genomic_xticks(ax)

def plot_tss(ax, tss, strand, axvline=False):
    arrow_direction = 8 if strand == -1 else 9
    ax.plot(tss, 1, lw=0, markersize=10, c='deepskyblue', marker=arrow_direction)
    ax.text(tss+1,0,gene_name)
    if axvline: ax.axvline(tss, c='deepskyblue', lw=0.5)

plot_tss(ax, tss, strand)
<!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd"> 2022-07-19T15:43:30.560584 image/svg+xml Matplotlib v3.5.2, https://matplotlib.org/

Now we'd like to score every PWM against every offset in the entire reference human genome. In order to accomplish that, we'll use MOODS, which implements a faster scanning algorithm in C++. We'll use this script to score the human reference genome with our PWMs.

PWMs: Score cutoffs

Once we have scanned a sequence of genomic DNA, scoring the PWM at every offset, we need to establish which of those scores is "significant" enough that we would predict the existence of a transcription factor binding site at that position in the genome. We can imagine two approaches to distinguish "significant" motif matches for each PWM. Thresholding on a particular score corresponds to predicting the TF is bound to sites which are $e^{\mathrm{score}}$ more likely under the PWM than random. A score cutoff of 6.91 is 1000x more likely under the PWM than random, for every PWM.

Contrarily, if you wanted to choose the 0.1% top scores for each PWM, each PWM would have a unique score cutoff, as each cutoff would depend on the distribution of scores specified by the PWM. At first this may seem surprising, so we'll explore it empirically for two PWMs:

pwm_names = ['M07944_2.00','M03355_2.00']
pwms = cisbp_pwms.loc[pwm_names]
score_pwms = cisbp_score_pwms.loc[pwm_names]
for name, pwm in pwms.items(): plot_pwm(pwm, figsize=(4,1)).set_title(name, loc='left')
def sample_scores_from_pwm(pwm, sample_size=int(1e6)):
    scores = np.zeros(sample_size)
    for i in range(len(pwm)):
        scores += np.random.choice(pwm[i], sample_size, p=bg)
    return pd.Series(scores)
score_samples = score_pwms.apply(sample_scores_from_pwm).T
ax = score_samples.plot.hist(bins=100, alpha=0.5)
ax.set(xlabel='score')
fig_style_2(ax)

Clearly we can see these two PWMs define different score distributions for random sequences. Let's see what probabilities the highest scores correspond to for each of these PWMs, using MOODS' score cutoff method:

def score_thresholds(score_pwm):
    min_significance, max_significance = -2, -15
    significance_range = min_significance - max_significance
    pvals = np.logspace(min_significance, max_significance, significance_range*2+1)
    score_thresholds = [MOODS.tools.threshold_from_p(score_pwm.T.tolist(), bg, p) for p in pvals]
    return pd.Series(score_thresholds, index=pvals)
score_quantiles = score_pwms.apply(score_thresholds).T.rename_axis('p').reset_index()

fig, ax = plt.subplots()

cols = score_quantiles.columns[1:]
for col in cols:
    score_quantiles.plot(x=col, y='p', logy=True, legend=False, ax=ax)

ax.set(ylabel='p_value', xlabel='score')
ax.grid(True, ls=':')
for side in ["right","top"]: ax.spines[side].set_visible(False)
ax.legend(cols)
ax.axhline(1e-3, c='red')
ax.text(0,2e-3, 'p=0.001')
ax.plot(score_quantiles.iloc[2][['M07944_2.00','M03355_2.00']],(1e-3, 1e-3), marker='o', lw=0, c='red')
None

For each motif, we can compute which score corresponds to each p-value cutoff, and then estimate p-values for scores of motif matches discovered during scanning using an interpolation. We'll use a generic spline as an interpolation function.

# cisbp_score_quantiles.to_csv('../data/equilibrium_TFs/cisbp_score_quantiles.csv', index=False)
cisbp_score_quantiles = pd.read_csv('../notebook_data/equilibrium_TFs/cisbp_score_quantiles.csv')
def create_score_to_pval_interpolant(motif_name):
    quantiles = cisbp_score_quantiles[[motif_name, 'p']]
    quantiles = quantiles[quantiles[motif_name] >= quantiles[motif_name].cummax()].drop_duplicates(subset=[motif_name], keep='first')  # guarantee strict monotonic increasing
    score_to_pval_interpolation = interpolate.InterpolatedUnivariateSpline(quantiles[motif_name], quantiles['p'], ext=3)
    return score_to_pval_interpolation
#     create_score_to_pval_interpolant(motif_name)
#     tfbs.loc[tfbs.name == motif_name, 'p'] = tfbs.loc[tfbs.name == motif_name, 'score'].apply(score_to_pval_interpolation)

PWMs: Other formalisms

Unfortunately, the PWM formalism we have introduced misses the biophysical interpretation we have carried throughout our analysis thus far. We can coax a biophysical interpretation from these PWMs as follows (following the approach from Foat, Morozov, Bussemaker, 2006):

If we consider the nucleotides independently, then the ratio of equilibrium binding to a given nucleotide $j$ versus the highest-affinity nucleotide $\mathrm{best}$ at each position is related to the difference in energies of binding:

$$ \frac{[TF:N_j]}{[TF:N_{best}]} = \frac{K_{a_j}}{K_{a_{best}}} = \exp \{\Delta G_j - \Delta G_{best} \} $$

With this expression, we can compute the energy of binding of a TF to a sequence relative to that TF's energy of binding to its best sequence of nucleotides. However, we need to know an absolute energy of binding to anchor this relative measure.

cisbp_energy_pwms = cisbp_pwms.apply(make_energy_pwm)
humanTFs_energy_pwms = humanTFs_pwms.apply(make_energy_pwm)
jaspar2022_energy_pwms = jaspar2022_pwms.apply(make_energy_pwm)

We can visualize this "energy PWM" as well. Visualizing energies of particular bases relative to SPI1's best sequence does not produce a visual representation that's easy to reason about:

SPI1_cisbp_energy_pwms = cisbp_energy_pwms.loc[SPI1_cisbp_pwms.index]
SPI1_cisbp_energy_pwm = SPI1_cisbp_energy_pwms[0]
ax = plot_pwm(SPI1_cisbp_energy_pwm)

We can rescale this matrix to the average sequence:

ax = plot_pwm(SPI1_cisbp_energy_pwm - np.expand_dims(SPI1_cisbp_energy_pwm.mean(axis=1), axis=1))

However, the ideal rescaling of this PWM would indicate whether each nucleotide contributes positively or negatively towards the energy of binding. After all, SPI1 likely doesn't bind the "average" sequence -- which is to say it's off rate is higher than it's on rate.

We chose SPI1 / PU.1 as our prototype in part because its absolute binding energies to various sequences have been measured, allowing us to anchor our relative energies PWM model. Pham et al measured PU.1 binding to a variety of high-affinity sequences by microscale thermophoresis and recorded a $k_d$ of 156nm for the best one.

SPI1_best_nanomolar_kd = 156
SPI1_best_ΔG = kcal_ΔG_from_nanomolar_kd(SPI1_best_nanomolar_kd)
SPI1_best_ΔG
9.648885505793956

However, the question remains of how to allocate those ~9.6 kcal/mol across the 14 bases of the SPI1 motif. The naive option is to uniformly spread the binding energy across the bases (9.6/14). Instead, we'll distribute it proportionally to the variance at each position to capture the intuition that the flanking nucleotides contribute less.

SPI1_cisbp_energy_pwm_scaled = make_abs_pwm(SPI1_cisbp_energy_pwm, SPI1_best_ΔG)
ax = plot_pwm(SPI1_cisbp_energy_pwm_scaled)

At last we have a visual representation of of a mono-nucleotide sequence preference model which captures our intuitions about the energetics of TF binding.

For a restricted set of TFs with high-quality HT-SELEX data, Rube et al produced relative energy PWMs with higher accuracy in the low-affinity regime. SPI1 is among that privileged set, so we'll take a look at that PWM for comparison.

SPI1_probound_pwms_scaled = SPI1_probound_pwms.apply(lambda pwm: make_abs_pwm(pwm, SPI1_best_ΔG))
ax = plot_pwm(SPI1_probound_pwms_scaled.iloc[2])

PWMs: Evaluation

To what extent do these PWM models predict real transcription factor binding? In order to evaluate these models, we would like to compare their predictions with ground truth measurements of transcription factor occupancy.

  • TF occupancy can be estimated with ChIP. Has been estimated in K562 (and HepG2)

Limitations:

  • We only have PWMs for 1000 TFs,
  • We only have ChIP for 600 TFs

What's the intersection?

all_chip_able_targets = pd.read_csv('/Users/alex/Documents/AChroMap/data/raw/ENCODE/k562_chip/metadata.cleaned.tsv', sep='\t').Target
pwm_cols = ['CISBP_2_strict','CISBP_2_intermediate','CISBP_2_tolerant','HumanTFs','JASPAR_2022','ProBound']
TF_coverage = {pwm_db: tfdb2[tfdb2.set_index('Name')[pwm_db].notnull().values].Name for pwm_db in pwm_cols}
fig, axs = plt.subplots(2, len(pwm_cols)//2)
for pwm_db, ax in zip(pwm_cols, axs.flatten()):
    colors = ['dodgerblue', 'seagreen', 'lightsteelblue']
    venn_obj = venn3((set(TF_coverage[pwm_db]), set(all_chip_able_targets), set(tfdb2.Name)),
                     (f'{pwm_db} ({len(set(TF_coverage[pwm_db]))})', f'ChIP in K562 ({len(set(all_chip_able_targets))})', f'DNA-binding TF ({len(set(tfdb2.Name))})'),
                     colors, alpha=0.6, ax=ax)
    for text in venn_obj.set_labels: text.set_fontsize(8)
    for text in [x for x in venn_obj.subset_labels if x]: text.set_fontsize(6)
    venn_obj.set_labels[0].set_fontweight(700)
    venn_obj.get_patch_by_id('111').set_edgecolor('green')
TFs_to_evaluate = set(all_chip_able_targets) & set(TF_coverage['CISBP_2_strict'])
pd.Series(list(TFs_to_evaluate)).to_csv('../notebook_data/TFs_to_evaluate.csv', index=False, header=False)

In ATAC OCRs

  • Justify only looking inside ATAC peaks / OCRs.

explain motivation: want to look in all ATAC regions for PWMs and chip signal in k562s

narrowpeak_cols = ['chrom','chromStart','chromEnd','name','score','strand','signalValue','pValue','qValue','summit']

ATAC_peaks_files = ['/Users/alex/Documents/AChroMap/data/raw/ENCODE/k562_atac/downloads/ENCFF333TAT.bed',
                    '/Users/alex/Documents/AChroMap/data/raw/ENCODE/k562_atac/downloads/ENCFF558BLC.bed']

ATAC_signal_files = ['/Users/alex/Documents/AChroMap/data/raw/ENCODE/k562_atac/downloads/ENCFF357GNC.bigWig',
                     '/Users/alex/Documents/AChroMap/data/raw/ENCODE/k562_atac/downloads/ENCFF600FDO.bigWig']
def filter_overlapping_peaks_for_max_signalValue(filepath, fraction_either=0.8):

    narrowpeaks_unfiltered = pd.read_csv(f'{filepath}', sep='\t', na_values=['NAN'], header=None, names=narrowpeak_cols)

    bedops_command = f"bedops -u {filepath} | cut -f1-4,7 | bedmap --fraction-either {fraction_either} --max-element - | sort-bed --unique - > {filepath}.tmp"
    os.system(bedops_command)
    narrowPeaks_filtered_peak_names = pd.read_csv(f'{filepath}.tmp', sep='\t', na_values=['NAN'], header=None, names=narrowpeak_cols[:5]).name
    os.remove(f'{filepath}.tmp')

    return narrowpeaks_unfiltered[narrowpeaks_unfiltered.name.isin(narrowPeaks_filtered_peak_names)]
K562_ATAC_peaks_1_filtered = filter_overlapping_peaks_for_max_signalValue(ATAC_peaks_files[0])
K562_ATAC_peaks_2_filtered = filter_overlapping_peaks_for_max_signalValue(ATAC_peaks_files[1])

K562_ATAC_peaks_1_filtered['signalValue_percentile'] = K562_ATAC_peaks_1_filtered.signalValue.rank(pct=True)
K562_ATAC_peaks_2_filtered['signalValue_percentile'] = K562_ATAC_peaks_2_filtered.signalValue.rank(pct=True)
def get_overlapping_peaks(peaks_bed, chrom, start, stop):

    intervals = pd.IntervalIndex.from_arrays(peaks_bed.chromStart, peaks_bed.chromEnd)

    return peaks_bed[(peaks_bed.chrom == chrom) & intervals.overlaps(pd.Interval(start, stop))]
atac_peak_at_SPI1_promoter_1 = get_overlapping_peaks(K562_ATAC_peaks_1_filtered, chrom, start, stop)
atac_peak_at_SPI1_promoter_2 = get_overlapping_peaks(K562_ATAC_peaks_2_filtered, chrom, start, stop)
def get_bigwig_values(url, chrom, start, stop):
    with pyBigWig.open(url) as bw:
        values = bw.values(chrom, start, stop)
    return values
ATAC_bigwig_1 = get_bigwig_values(ATAC_signal_files[0], chrom, earliest_start, latest_end)
ATAC_bigwig_2 = get_bigwig_values(ATAC_signal_files[1], chrom, earliest_start, latest_end)
ATAC_bigwig = pd.DataFrame([ATAC_bigwig_1, ATAC_bigwig_2], columns=range(earliest_start, latest_end), index=['ATAC_1', 'ATAC_2']).T
ax = ATAC_bigwig.plot.line()
plot_tss(ax, tss, strand)
genomic_xticks(ax)

from this we conclude that the first set of ATAC peaks is a richer dataset, and proceed with those

ATAC_OCRs_to_evaluate_PWMs_in = K562_ATAC_peaks_1_filtered[K562_ATAC_peaks_1_filtered.score == 1000]
ATAC_OCRs_to_evaluate_PWMs_in.to_csv('../notebook_data/equilibrium_TFs/K562_ATAC_peaks_filtered.bed', sep='\t', index=False)

Get DGF

motif_cluster_and_gene = pd.read_csv('/Users/alex/Documents/AChroMap/data/raw/Vierstra_supp/motif_cluster_and_gene.csv', index_col=0)
motif_clusters_to_TFs = pd.read_csv('/Users/alex/Documents/AChroMap/data/raw/Vierstra_supp/motif_clusters_to_TFs.csv', index_col=0)
motif_clusters_to_TFs = motif_clusters_to_TFs.set_index('Name')['gene'].str.split(';')

DGF_footprint_index = pd.read_csv('/Users/alex/Documents/AChroMap/data/raw/Vierstra_supp/consensus_index_matrix_full_hg38.index.csv', index_col=0, header=None).index
DGF_samples_index = pd.read_csv('/Users/alex/Documents/AChroMap/data/raw/Vierstra_supp/consensus_index_matrix_full_hg38.columns.csv', index_col=0, header=None).index
K562_DGF_samples = DGF_samples_index[DGF_samples_index.str.startswith('K562')].tolist()
def get_k562_DGF(chrom, start, end):

    dgf_path = '/Users/alex/Documents/AChroMap/data/raw/Vierstra_supp/consensus_footprints_and_collapsed_motifs_hg38.bed.gz'
    tabix_coords = chrom+':'+str(start)+'-'+str(end)
    cols = ['contig','start','stop','identifier','mean_signal','num_samples','num_fps','width','summit_pos','core_start','core_end','motif_clusters']
    tabix_command = f'tabix {dgf_path} {tabix_coords}'
    footprints_contained_in_region = read_shell(shlex.split(tabix_command), sep='\t', header=None, names=cols, dtype={'index_id': str})

    footprints_contained_in_region['TFs'] = footprints_contained_in_region.motif_clusters.str.split(';').apply(lambda l: [motif_clusters_to_TFs[motif_cluster] for motif_cluster in l] if (type(l) == list) else [])
    first_dgf_index = DGF_footprint_index.get_loc(footprints_contained_in_region.identifier.iloc[0])
    last_dgf_index = DGF_footprint_index.get_loc(footprints_contained_in_region.identifier.iloc[-1])+1

    footprint_posterior = pd.read_hdf('/Users/alex/Documents/AChroMap/data/raw/Vierstra_supp/consensus_index_matrix_full_hg38.hdf', key='consensus_index_matrix_full_hg38',
                                      start=first_dgf_index, stop=last_dgf_index, columns=K562_DGF_samples)

    footprint_binary = pd.read_hdf('/Users/alex/Documents/AChroMap/data/raw/Vierstra_supp/consensus_index_matrix_binary_hg38.hdf', key='consensus_index_matrix_full_hg38',
                                   start=first_dgf_index, stop=last_dgf_index, columns=K562_DGF_samples)

    k562_dgf = footprints_contained_in_region.merge(footprint_posterior, how='left', left_on='identifier', right_index=True)
    k562_dgf = k562_dgf.merge(footprint_binary, how='left', left_on='identifier', right_index=True, suffixes=['_posterior','_binary'])

    return k562_dgf
k562_dgf = get_k562_DGF(chrom, start, stop)
k562_dgf.plot.scatter(x='K562-DS15363_posterior', y='K562-DS16924_posterior', figsize=(4,4), logx=True, logy=True)
<AxesSubplot:xlabel='K562-DS15363_posterior', ylabel='K562-DS16924_posterior'>
<!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd"> 2022-07-19T14:24:49.694426 image/svg+xml Matplotlib v3.5.2, https://matplotlib.org/

Load K562 RNA

ENCODE_RNA_metadata = pd.read_csv('../../AChroMap/data/raw/ENCODE/rna/metadata.tsv', sep='\t')
ENCODE_RNA_metadata_cleaned = pd.read_csv('../../AChroMap/data/raw/ENCODE/rna/metadata.clean.typed.csv')
ENCODE_polyA_metadata = pd.read_csv('../../AChroMap/data/raw/ENCODE/polyA/metadata.tsv', sep='\t')
ENCODE_polyA_metadata_cleaned = pd.read_csv('../../AChroMap/data/raw/ENCODE/polyA/metadata.clean.typed.csv')

rna_counts = pd.read_csv('../../AChroMap/data/raw/ENCODE/rna/RSEM_gene/RSEM_gene.counts_matrix.wellexpressed_deseq.csv', index_col=0)
polyA_counts = pd.read_csv('../../AChroMap/data/raw/ENCODE/polyA/RSEM_gene/RSEM_gene.counts_matrix.wellexpressed_deseq.csv', index_col=0)

K562_reference_polyA = pd.read_csv('/Users/alex/Desktop/ENCFF472HFI.tsv', sep='\t')
K562_reference_polyA = K562_reference_polyA[K562_reference_polyA.gene_id.str.startswith('ENSG')]
K562_reference_polyA['gene_id'] = K562_reference_polyA.gene_id.str.split('.').str[0]
K562_reference_polyA = K562_reference_polyA.set_index('gene_id')

K562_RNA_metadata = ENCODE_RNA_metadata[ENCODE_RNA_metadata['Biosample term name'] == 'K562']
K562_RNA_metadata_cleaned = ENCODE_RNA_metadata_cleaned[ENCODE_RNA_metadata_cleaned['Biosample term name'] == 'K562']
K562_polyA_metadata = ENCODE_polyA_metadata[ENCODE_polyA_metadata['Biosample term name'] == 'K562']
K562_polyA_metadata_cleaned = ENCODE_polyA_metadata_cleaned[ENCODE_polyA_metadata_cleaned['Biosample term name'] == 'K562']

K562_RNA_metadata_cleaned = K562_RNA_metadata_cleaned[K562_RNA_metadata_cleaned.type == 'RSEM_gene']
K562_polyA_metadata_cleaned = K562_polyA_metadata_cleaned[K562_polyA_metadata_cleaned.type == 'RSEM_gene']

K562_RNA_metadata = K562_RNA_metadata[K562_RNA_metadata['File accession'].isin(K562_RNA_metadata_cleaned.file)]
K562_polyA_metadata = K562_polyA_metadata[K562_polyA_metadata['File accession'].isin(K562_polyA_metadata_cleaned.file)]

K562_RNA_metadata = K562_RNA_metadata[K562_RNA_metadata['Audit WARNING'].isnull() & K562_RNA_metadata['Audit ERROR'].isnull() & K562_RNA_metadata['Audit NOT_COMPLIANT'].isnull()]
K562_polyA_metadata = K562_polyA_metadata[K562_polyA_metadata['Audit WARNING'].isnull() & K562_polyA_metadata['Audit ERROR'].isnull() & K562_polyA_metadata['Audit NOT_COMPLIANT'].isnull()]

K562_RNA_metadata_cleaned = K562_RNA_metadata_cleaned[K562_RNA_metadata_cleaned.file.isin(K562_RNA_metadata['File accession'])]
K562_polyA_metadata_cleaned = K562_polyA_metadata_cleaned[K562_polyA_metadata_cleaned.file.isin(K562_polyA_metadata['File accession'])]

K562_rna_counts = rna_counts.loc[rna_counts.index.str.startswith('ENSG'), rna_counts.columns.isin(K562_RNA_metadata['File accession'])]
K562_polyA_counts = polyA_counts.loc[polyA_counts.index.str.startswith('ENSG'), polyA_counts.columns.isin(K562_polyA_metadata['File accession'])]

K562_rna_counts.index = K562_rna_counts.index.str.split('.').str[0]
K562_polyA_counts.index = K562_polyA_counts.index.str.split('.').str[0]
best_polyA_files = K562_polyA_metadata_cleaned[K562_polyA_metadata_cleaned.experiment.isin(['ENCSR000AEP','ENCSR000AEQ'])].file.tolist()
best_rna_files = K562_RNA_metadata_cleaned[K562_RNA_metadata_cleaned.experiment.isin(['ENCSR792OIJ'])].file.tolist()

def series_to_distplot(s):
    sns.kdeplot(data=s)
    sns.rugplot(data=s, height=.1)

rna_counts_sum = K562_rna_counts.sum()
series_to_distplot(rna_counts_sum)
ax = plt.gca()
for x in rna_counts_sum[best_rna_files].values:
    ax.axvline(x, c='r', lw=0.3)

plt.subplots()
polyA_counts_sum = K562_polyA_counts.sum()
series_to_distplot(polyA_counts_sum)
ax = plt.gca()
for x in polyA_counts_sum[best_polyA_files].values:
    ax.axvline(x, c='r', lw=0.3)
<!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd"> 2022-07-20T11:59:09.721224 image/svg+xml Matplotlib v3.5.2, https://matplotlib.org/
<!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd"> 2022-07-20T11:59:09.792664 image/svg+xml Matplotlib v3.5.2, https://matplotlib.org/
mRNAs_per_cell = 1e5  # citation follows
RNAs_per_cell = 4e5  # this one is a guess

K562_polyA_TPC = K562_polyA_counts / K562_polyA_counts.sum() * mRNAs_per_cell
K562_rna_TPC = K562_rna_counts / K562_rna_counts.sum() * RNAs_per_cell
K562_RNA_TF_TPC = K562_rna_TPC[K562_rna_TPC.index.isin(tfdb2.ID)]
K562_polyA_TF_TPC = K562_polyA_TPC[K562_polyA_TPC.index.isin(tfdb2.ID)]
K562_polyA_TF_TPC.index = tfdb2.set_index('ID').reindex(K562_polyA_TF_TPC.index).Name.values
plt.rcParams['figure.figsize'] = [17, 5]
g = sns.stripplot(data=K562_polyA_TF_TPC.iloc[:100].T, alpha=0.4)
plt.xticks(rotation=-90)

g = sns.stripplot(data=K562_polyA_TF_TPC.iloc[:100][best_polyA_files].T, color='black', s=2, marker="D")
# also plot the median

None
<!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd"> 2022-07-20T12:38:35.153413 image/svg+xml Matplotlib v3.5.2, https://matplotlib.org/
 
K562_polyA_TF_TPC.to_csv('../notebook_data/equilibrium_TFs/K562_TF_RNA.csv')
RNA_to_protein_linear_scaling_factor = 9800

K562_TF_copy_number = K562_polyA_TF_TPC.replace(0, np.nan).median(axis=1).replace(np.nan, 0) * RNA_to_protein_linear_scaling_factor
plt.rcParams['figure.figsize'] = [12, 5]

K562_TF_copy_number.plot.hist(bins=100, logy=True)
<AxesSubplot:ylabel='Frequency'>
<!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd"> 2022-07-20T13:50:09.911002 image/svg+xml Matplotlib v3.5.2, https://matplotlib.org/
K562_TF_nanomolar_conc = K562_TF_copy_number.apply(copy_number_and_cubic_micron_volume_to_molar_concentration, args=(K562_volume_micron_cubed,)) * 1e9
K562_TF_RNA_concise = pd.concat((tfdb2.set_index('Name').ID.reindex(K562_TF_copy_number.index),
                                 K562_TF_copy_number.rename('TF_protein_copy_number_estimate'),
                                 K562_TF_nanomolar_conc.rename('nanomolar_conc')), axis=1)

K562_TF_RNA_concise = K562_TF_RNA_concise.rename_axis('Name').reset_index().set_index('ID')
K562_TF_RNA_concise = K562_TF_RNA_concise.sort_values('TF_protein_copy_number_estimate', ascending=False).drop_duplicates(subset=['Name'])

K562_TF_RNA_concise.to_csv('../notebook_data/equilibrium_TFs/K562_TF_RNA_concise.csv')

Evaluation of PWMs at the SPI1 promoter

We've just generated a list of OCRs we want to evaluate PWMs for, but let's start with our single example to determine how to evaluate PWMs vs ChIP.

# chrom, strand, tss = get_reference_transcript(gene_name)
# start = tss-400
# stop = tss+400
# K562_TF_RNA = pd.read_csv('../notebook_data/equilibrium_TFs/K562_TF_RNA.csv', index_col=0)
Get TF ChIP Peaks at SPI1 Promoter
def get_K562_TF_ChIP_peaks(chrom, start, end):

    k562_merged_ChIP_path = '/Users/alex/Documents/AChroMap/data/raw/ENCODE/k562_chip/K562_ChIP_merged.bed.gz'
    tabix_coords = chrom+':'+str(start)+'-'+str(end)
    tabix_command = f'tabix {k562_merged_ChIP_path} {tabix_coords}'
    peaks_contained_in_region = read_shell(shlex.split(tabix_command), sep='\t', header=None, names=['chrom','chromStart','chromEnd','name','signalValue'])

    return peaks_contained_in_region
K562_SPI1_TF_chip_peaks = get_K562_TF_ChIP_peaks(chrom, start, stop)
peaks_df = K562_SPI1_TF_chip_peaks[K562_SPI1_TF_chip_peaks.name.isin(TFs_to_evaluate)]
Get TF ChIP signal over background at SPI1 promoter
SPI1_promoter_TF_ChIP_signal = pd.read_csv('../notebook_data/equilibrium_TFs/SPI1_promoter_TF_ChIP_signal.csv', index_col=0)
SPI1_promoter_TF_ChIP_signal = SPI1_promoter_TF_ChIP_signal.clip(lower=1).replace(1, np.nan)
signal_df = SPI1_promoter_TF_ChIP_signal.loc[:, SPI1_promoter_TF_ChIP_signal.columns.str.split('_').str[0].isin(TFs_to_evaluate)]
signal_df = signal_df[signal_df.max(axis=0).sort_values(ascending=False).index.values]
Get ATAC signal over background at SPI1 promoter
SPI1_promoter_TF_ATAC_signal = pd.Series(get_bigwig_values(ATAC_signal_files[0], chrom, start, stop), index=range(start, stop), name='ATAC_signal')
SPI1_promoter_TF_ATAC_signal = SPI1_promoter_TF_ATAC_signal.clip(lower=1).replace(1, np.nan)
Get PWM predictions at SPI1 promoter
SPI1_key = f'{chrom}/{atac_peak_at_SPI1_promoter_1.chromStart.iat[0]}-{atac_peak_at_SPI1_promoter_1.chromEnd.iat[0]}'
SPI1_cisbp_tfbs = pd.read_hdf('../../AChroMap/scripts/cisbp2_vs_chip.hdf', SPI1_key)
SPI1_cisbp_tfbs = SPI1_cisbp_tfbs[(SPI1_cisbp_tfbs.start > start) & (SPI1_cisbp_tfbs.end < stop)]
SPI1_cisbp_tfbs['p'] = SPI1_cisbp_tfbs.p.clip(lower=1e-10)
SPI1_cisbp_tfbs['log10p'] = -np.log10(SPI1_cisbp_tfbs.p)
3D Ridgeline
signal_df = SPI1_promoter_TF_ChIP_signal.loc[:, SPI1_promoter_TF_ChIP_signal.columns.str.split('_').str[0].isin(TFs_to_evaluate)]
TF_order = signal_df.max(axis=0).sort_values().index.str.split('_').str[0].drop_duplicates(keep='first')
column_order = pd.Series({col: (TF_order.get_loc(col.split('_')[0]), int(col.split('_')[1])) for col in signal_df.columns}).sort_values().index
signal_df = signal_df[column_order]
signal_df_20 = signal_df.iloc[:, -20:]
columns_to_TF = signal_df_20.columns.to_frame()[0].str.split('_').str[0].rename('TF').rename_axis('track').reset_index().reset_index().set_index('track')
TF_to_columns = columns_to_TF.reset_index().set_index('TF')
plotted_TFs = set(TF_to_columns.index)
genome_linspace = np.transpose(np.tile(signal_df_20.index.values, (len(signal_df_20.T), 1)))
print('genome_linspace:', genome_linspace.shape)
signal_heights = signal_df_20.values
print('signal_heights:\t', signal_heights.shape)
TF_y_index = np.linspace(0,len(signal_df_20.columns)-1,len(signal_df_20.columns))
print('TF_y_index: \t', TF_y_index.shape)
genome_linspace: (800, 20)
signal_heights:	 (800, 20)
TF_y_index: 	 (20,)
signal_verts = []
for y_i in range(len(TF_y_index)):
    # zero at the beginning and the end to get a nice flat bottom on the polygons
    xs = np.concatenate([[genome_linspace[0,y_i]], genome_linspace[:,y_i], [genome_linspace[-1,y_i]]])
    ys = np.concatenate([[0],signal_heights[:,y_i],[0]])
    signal_verts.append(list(zip(xs, ys)))
colors = LinearSegmentedColormap('colormap', cm.jet._segmentdata.copy(), 20)
colors = [colors(i) for i in range(20)]
peak_verts = []
peak_offsets = []

for col, d in columns_to_TF.iterrows():
    for i, peak in peaks_df[peaks_df['name'] == d.TF].iterrows():
        xs = [peak.chromStart, peak.chromStart, peak.chromEnd, peak.chromEnd]
        ys = [0, peak.signalValue/20, peak.signalValue/20, 0]
        peak_verts.append(list(zip(xs, ys)))
        peak_offsets.append(d['index'])
tfbs_verts = []
tfbs_offsets = []

for col, d in columns_to_TF.iterrows():
    for i, tfbs in SPI1_cisbp_tfbs[SPI1_cisbp_tfbs['TFs'] == d.TF].iterrows():
        xs = [tfbs.start, tfbs.start, tfbs.end, tfbs.end]
        ys = [0, tfbs.score/50, tfbs.score/50, 0]
        tfbs_verts.append(list(zip(xs, ys)))
        tfbs_offsets.append(d['index'])
plt.rcParams['figure.figsize'] = [10, len(signal_df.columns)]

fig = plt.figure()
ax = fig.add_subplot(111, projection='3d')

signal_poly = PolyCollection(signal_verts, facecolors=colors)
signal_poly.set_alpha(0.7)
ax.add_collection3d(signal_poly, zs=TF_y_index, zdir='y')

peak_poly = PolyCollection(peak_verts, edgecolors=(0,0,0,0.3), facecolors=(0,0,0,0))
# peak_poly.set_alpha(0.4)
ax.add_collection3d(peak_poly, zs=peak_offsets, zdir='y')

tfbs_poly = PolyCollection(tfbs_verts)
tfbs_poly.set_alpha(1)
ax.add_collection3d(tfbs_poly, zs=tfbs_offsets, zdir='y')


ax.set_xlim3d(genome_linspace.min(), genome_linspace.max())
ax.set_xlabel(chrom)
ax.set_ylim3d(TF_y_index.min(), TF_y_index.max())
ax.set_ylabel('TF')
ax.set_zlim3d(signal_heights.min(), signal_heights.max())
ax.set_zlabel('signal fold change over background')

xtick_vals = ax.get_xticks()
ax.set_xticks(xtick_vals)
ax.set_xticklabels(['{:.0f}'.format(x) for x in xtick_vals])

ax.set_yticks(TF_y_index)
ax.set_yticklabels(signal_df.columns)


ax.xaxis.pane.fill = False
ax.yaxis.pane.fill = False
ax.zaxis.pane.fill = False
ax.xaxis.pane.set_edgecolor('w')
ax.yaxis.pane.set_edgecolor('w')
ax.zaxis.pane.set_edgecolor('w')
ax.grid(False)


ax.get_proj = lambda: np.dot(Axes3D.get_proj(ax), np.diag([1.0, 1.5, 1.0, 1.0]))


plt.show()
---------------------------------------------------------------------------
ValueError                                Traceback (most recent call last)
Input In [156], in <cell line: 23>()
     21 ax.set_ylim3d(TF_y_index.min(), TF_y_index.max())
     22 ax.set_ylabel('TF')
---> 23 ax.set_zlim3d(signal_heights.min(), signal_heights.max())
     24 ax.set_zlabel('signal fold change over background')
     26 xtick_vals = ax.get_xticks()

File ~/miniconda3/envs/py39/lib/python3.9/site-packages/mpl_toolkits/mplot3d/axes3d.py:865, in Axes3D.set_zlim3d(self, bottom, top, emit, auto, zmin, zmax)
    862     top = zmax
    864 self._process_unit_info([("z", (bottom, top))], convert=False)
--> 865 bottom = self._validate_converted_limits(bottom, self.convert_zunits)
    866 top = self._validate_converted_limits(top, self.convert_zunits)
    868 old_bottom, old_top = self.get_zlim()

File ~/miniconda3/envs/py39/lib/python3.9/site-packages/matplotlib/axes/_base.py:3614, in _AxesBase._validate_converted_limits(self, limit, convert)
   3611 converted_limit = convert(limit)
   3612 if (isinstance(converted_limit, Real)
   3613         and not np.isfinite(converted_limit)):
-> 3614     raise ValueError("Axis limits cannot be NaN or Inf")
   3615 return converted_limit

ValueError: Axis limits cannot be NaN or Inf
<!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd"> 2022-07-13T10:58:49.045547 image/svg+xml Matplotlib v3.5.2, https://matplotlib.org/
2D Ridgeline
import matplotlib.style as mplstyle
mplstyle.use('fast')

def style_ax(ax):
    ax.spines['top'].set_visible(False)
    ax.spines['right'].set_visible(False)
    ax.spines['bottom'].set_visible(False)
    ax.patch.set_alpha(0)
from matplotlib.ticker import Locator


class MinorSymLogLocator(Locator):
    """
    Dynamically find minor tick positions based on the positions of
    major ticks for a symlog scaling.
    """
    def __init__(self, linthresh):
        """
        Ticks will be placed between the major ticks.
        The placement is linear for x between -linthresh and linthresh,
        otherwise its logarithmically
        """
        self.linthresh = linthresh

    def __call__(self):
        'Return the locations of the ticks'
        majorlocs = self.axis.get_majorticklocs()

        # iterate through minor locs
        minorlocs = []

        # handle the lowest part
        for i in range(1, len(majorlocs)):
            majorstep = majorlocs[i] - majorlocs[i-1]
            if abs(majorlocs[i-1] + majorstep/2) < self.linthresh:
                ndivs = 10
            else:
                ndivs = 9
            minorstep = majorstep / ndivs
            locs = np.arange(majorlocs[i-1], majorlocs[i], minorstep)[1:]
            minorlocs.extend(locs)

        return self.raise_if_exceeds(np.array(minorlocs))

    def tick_values(self, vmin, vmax):
        raise NotImplementedError('Cannot get tick locations for a '
                                  '%s type.' % type(self))
def style_stripplot(ax):

    ax.set_xscale('symlog', linthresh=2)
    ax.get_xaxis().set_major_formatter(matplotlib.ticker.ScalarFormatter())
    # ax.xaxis.grid(True, which='minor')
    ax.set_xlim([0, 200])
    ax.set_xticks([0, 1, 10, 100, 200])
    ax.xaxis.set_minor_locator(MinorSymLogLocator(1e-1))
signal_df2 = signal_df[signal_df.max(axis=0).sort_values(ascending=False).index.values].iloc[:, :10]
K562_polyA_TF_TPC_medians = K562_polyA_TF_TPC.replace(0, np.nan).median(axis=1).fillna(0)
# I want a nucleosome binding energy track on this figure
# chip peaks could be triangles or some other shape -- especially if we had the summit
# are the summits always in the middle?

# show the motif on the screen somewhere?
# fully featured genomics feature track?
# plot the problem statement
# maybe I should be plotting the TF's p-values rather than scores? coloring by correlation or something?
# TFBS: 2 colors: below threshold and above threshold
plot_chip_peaks = True
plot_chip_signal = True
plot_atac_signal = True
plot_tfbs = True
plot_dgf = True

num_rows = 1+len(signal_df2.columns)

plt.rcParams['figure.figsize'] = [18, num_rows]
plt.rcParams['path.simplify_threshold'] = 1.0

TF_names = signal_df2.columns.str.split('_').str[0].unique()
fig, axs = plt.subplots(len(TF_names), 2, sharex='col', gridspec_kw={'width_ratios': [3, 1]})
left_axs = [row[0] for row in axs]
row_dict = dict(zip(TF_names, axs[:-1]))


if plot_atac_signal:
    SPI1_promoter_TF_ATAC_signal.plot.line(ax=left_axs[-1], ylim=(0, SPI1_promoter_TF_ATAC_signal.max()), xlim=(start, stop), c='black', label='ATAC')
    left_axs[-1].set_ylabel('ATAC', rotation=0)
    plot_tss(left_axs[-1], tss, strand, axvline=True)
    style_ax(left_axs[-1])

for i, (TF_name, row) in enumerate(row_dict.items()):

    row[0].set_xlim([start, stop])
    row[0].set_ylim([0, 30])
    style_ax(row[0])
    color = 'darkblue' if i%2 == 0 else 'royalblue'

    for uid in signal_df2.loc[:, signal_df2.columns.str.split('_').str[0] == TF_name].columns:
        line = row[0].plot(signal_df2.index.values, signal_df2[uid].values, label=uid, clip_on=False, color=color, lw=1)
        # ax.legend(handles=line, loc='upper left', borderaxespad=0, frameon=False)

    g1 = sns.stripplot(data=K562_polyA_TF_TPC.loc[TF_name].to_frame(), x=TF_name, orient='h', alpha=0.5, c='lightblue', ax=row[1])
    g2 = sns.stripplot(data=K562_polyA_TF_TPC.loc[TF_name, best_polyA_files].to_frame(), x=TF_name, orient='h', color='red', ax=row[1])
    g3 = sns.stripplot(data=K562_polyA_TF_TPC_medians.to_frame().loc[[TF_name]].T, x=TF_name, orient='h', color='black', marker='D', ax=row[1])
    style_ax(row[1])
    row[1].set_xlim(0, K562_polyA_TF_TPC.max().max())
    row[1].set_ylabel(TF_name, rotation=0)
    # row[1].set_xscale('symlog', linthresh=1)
    # row[1].plot(K562_polyA_TF_TPC_medians.at[TF_name], TF_name, 'ko')
    if i == 0:
        row[1].spines['top'].set_visible(True)
        style_stripplot(row[1])

if plot_chip_peaks:
    for index, peak in peaks_df.iterrows():
        if peak['name'] in row_dict.keys():
            ax = row_dict[peak['name']][0]
            ax.add_patch(Rectangle((peak.chromStart, 0), peak.chromEnd-peak.chromStart, 30, fc=(1,0,0,np.clip(0.0005*peak.signalValue, a_min=0, a_max=1)), ec=(1,0,0,0.1), zorder=-1, clip_on=False))

if plot_tfbs:
    tfbs_cm = matplotlib.cm.ScalarMappable(norm=matplotlib.colors.Normalize(vmin=0, vmax=20), cmap=matplotlib.cm.OrRd)
    for index, tfbs in SPI1_cisbp_tfbs.iterrows():
        if tfbs['TFs'] in row_dict.keys():
            ax = row_dict[tfbs['TFs']][0]
            ax.add_patch(Rectangle((tfbs.start, 0), tfbs.end-tfbs.start, (tfbs.log10p-2)*4, fc=tfbs_cm.to_rgba(tfbs.log10p), ec=(0,0,0,0), zorder=10, clip_on=False))

            # fc=(0,1,0,np.clip(0.01*tfbs.log10p, a_min=0, a_max=1)),

if plot_dgf:
    last_ax = left_axs[-1]
    for index, dgf in k562_dgf.iterrows():
        alpha = 0.005*(dgf['K562-DS15363_posterior'] + dgf['K562-DS16924_posterior'])/2
        _,top = fig.transFigure.inverted().transform(left_axs[0].transAxes.transform([0,1]))
        _,bottom = fig.transFigure.inverted().transform(left_axs[-1].transAxes.transform([0,0]))
        trans = matplotlib.transforms.blended_transform_factory(left_axs[0].transData, fig.transFigure)
        fig.add_artist(Rectangle((dgf.core_start,bottom), dgf.core_end-dgf.core_start, top-bottom, transform=trans, fc=(0,0,1,alpha), ec=None, zorder=-10))

genomic_xticks(left_axs[-1], chrom=chrom)
axs[-1][1].axis('off')
axs[0][1].xaxis.set_tick_params(labeltop=True)

plt.savefig('/Users/alex/Desktop/SPI1_promoter_K562_TF_ChIP.png')
None
<!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd"> 2022-07-20T15:14:24.932483 image/svg+xml Matplotlib v3.5.2, https://matplotlib.org/
Scatterplots
max_chip_peak_height = peaks_df.groupby('name')['signalValue'].max().rename('max_chip_peak_height')
max_chip_peak_height
name
ATF1        278.59146
ATF2        671.55342
ATF3       2017.85285
ATF4         61.95164
ATF7       1206.30707
              ...    
ZKSCAN1      28.54167
ZNF175       50.23833
ZNF281      112.63834
ZNF282       31.21194
ZNF766       56.29987
Name: max_chip_peak_height, Length: 87, dtype: float64
def set_colors(df, x_col, y_col):

    df['c'] = np.nan

    df.loc[(df[y_col] > 0) & (df[x_col] > 0), 'c'] = 'g'
    df.loc[(df[y_col] > 0) & (df[x_col] <= 0), 'c'] = 'm'
    df.loc[(df[y_col] <= 0) & (df[x_col] > 0), 'c'] = 'r'
    df.loc[(df[y_col] <= 0) & (df[x_col] <= 0), 'c'] = 'c'
    return df
K562_TF_RNA = pd.read_csv('../../back_of_my_envelope/data/equilibrium_TFs/K562_TF_RNA.csv', index_col=0)
K562_TF_RNA = K562_TF_RNA.replace(0, np.nan).median(axis=1).replace(np.nan, 0).rename('TF_RNA')
K562_TF_RNA
TFAP2A     0.082112
TFAP2B     0.019229
TFAP2C     0.024566
TFAP2D     0.000000
TFAP2E     0.029581
            ...    
MTERF1     8.131813
MTERF2    12.372807
TP53       2.256278
TP63       0.674158
TP73       0.592430
Name: TF_RNA, Length: 1635, dtype: float64
def process_peak_tfbs_df(tfbs_df):

    tfbs_df = tfbs_df[tfbs_df.TFs.isin(TFs_to_evaluate)]
    tfbs_df.p.clip(lower=1e-10, upper=None, inplace=True)
    tfbs_df['log10p'] = -np.log10(tfbs_df.p)
    tfbs_df = tfbs_df.merge(max_chip_peak_height, how='left', left_on='TFs', right_index=True)
    tfbs_df = tfbs_df.merge(K562_TF_RNA, how='left', left_on='TFs', right_index=True)
    tfbs_df['score_x_RNA'] = ln(exp(tfbs_df['score']) * tfbs_df['TF_RNA'])
    tfbs_df['log10p_x_RNA'] = tfbs_df['log10p'] * tfbs_df['TF_RNA']
    return tfbs_df.reset_index(drop=True)

    # distance to peak center
    # dgf
tfbs_df = process_peak_tfbs_df(SPI1_cisbp_tfbs)
def lims(series, buffer=0.01):

    spread = series.max() - series.min()
    limits = (series.min() - spread*buffer, series.max() + spread*buffer)
    return limits

def log_lims(series, log_buffer=1):

    lower = np.log10(series[series > 0].min()) - log_buffer
    upper = np.log10(series[series > 0].max()) + log_buffer
    return (lower, upper)
def spearman_corr(df, tfbs_col, chip_col): return df.loc[:, [tfbs_col, chip_col]].corr(method='spearman').loc[tfbs_col, chip_col]

spearman_corr(tfbs_df, 'score', 'max_signal'), spearman_corr(tfbs_df, 'score_x_RNA', 'max_signal')
(0.07881793222722186, 0.06831818983387146)
def plot_peak_scatter(df, mode='hist', x_col='score', y_col='max_signal', log=False, legend=False, ylim=(-0.1, 20)):

    palette={'g':'g','m':'m','r':'r','c':'c'}

    df = set_colors(df, x_col, y_col)
    df['chip_signalBinary'] = (df[y_col] > 0).astype(int)
    df['pwm_scoreBinary'] = (df[x_col] > 0).astype(int)

    g = sns.JointGrid(data=df, x=x_col, y=y_col, xlim=lims(df[x_col]), ylim=ylim, hue='c', palette=palette)
    g.plot_joint(sns.scatterplot, alpha=0.2, s=5, legend=legend)

    if mode == 'hist':
        sns.histplot(data=df, x=x_col, bins=100, ax=g.ax_marg_x, hue='chip_signalBinary', palette={0:'r', 1:'g'}, legend=False, log_scale=(False, True),element="step")
        if log:
            sns.histplot(data=df, y=y_col, bins=[0, 1]+np.logspace(1, 5).tolist(), ax=g.ax_marg_y, hue='pwm_scoreBinary', palette={0:'m', 1:'g'}, legend=False, log_scale=(True, False),element="step")
        else:
            sns.histplot(data=df, y=y_col, bins=200, ax=g.ax_marg_y, hue='pwm_scoreBinary', palette={0:'m', 1:'g'}, legend=False, log_scale=(True, False),element="step")

        g.ax_marg_y.tick_params(labeltop=True)
        g.ax_marg_y.grid(True, axis='x', ls=':')

        g.ax_marg_x.tick_params(labelleft=True)
        g.ax_marg_x.grid(True, axis='y', ls=':')

    elif mode=='kde':
        sns.kdeplot(data=df, x=x_col, ax=g.ax_marg_x, hue='chip_signalBinary', palette={0:'r', 1:'g'}, fill=True, alpha=0.1, legend=False)
        sns.kdeplot(data=df, y=y_col, ax=g.ax_marg_y, hue='pwm_scoreBinary', palette={0:'m', 1:'g'}, fill=True, alpha=0.1, legend=False, log_scale=(False, True))

    g.fig.set_figwidth(10)
    g.fig.set_figheight(5)

    corr = spearman_corr(df, x_col, y_col)
    g.fig.suptitle(f'Spearman_correlation: {round(corr, 4)}')

    if legend:
        handles, labels = g.ax_joint.get_legend_handles_labels()
        replacement = {'g':'Motif match and ChIP peak',
                       'm':'ChIP peak without motif match',
                       'r':'Motif match without ChIP peak',
                       'c':'Neither motif match nor ChIP Peak'}
        labels = [replacement[x] for x in labels]
        legend = g.ax_joint.legend(handles, labels, loc='upper left')

    if log:
        g.ax_joint.set_yscale('symlog', linthresh=min(0.1, df[df.max_signal > 0].max_signal.min()))

    return g, corr
g = plot_peak_scatter(tfbs_df, x_col='score', y_col='max_signal')